The pTargeT™ Sequencing Primer is designed for sequencing inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410). The sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector.
The primer can be used only for sequencing inserts cloned into the pTargeT™ Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts.
The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.
The primer is supplied at a concentra...
Expand to Read More »
The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.
« Collapse Content
pTargeT™ Sequencing Primer
pTargeT™ Sequencing Primer (24mer)
This product can be added to a
Helix Freezer
This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.
Already a Helix Customer?
Store at –20°C.
For product intended use please see Patents & Disclaimers tab.
Q4461 For Research Use Only. Not for Use in Diagnostic Procedures.